Lecture 3

The Polymerase Chain Reaction

Being sophisticated students, I won't be able to surprise you with the news that there is a technique called the Polymerase Chain Reaction, and that it has revolutionized the way that molecular biology is conducted.

I'm always amused by the science instructional materials for young children that profess that they teach the nature of science, but for some reason they never get around to talking about Kary Mullis, LSD, California's Highway 128, and mile-marker 46.58.

• Author of "Dancing Naked in the Mind Field"
• Mullis is like hangin' 10 in La Jolla, surfin' every day, brewskies in the fridge, LSD whenever.
• Just a Good Ole Boy with a beachfront apartment and a Nobel Prize
• Religion and Psychoactive Sacraments: An Entheogen Chrestomathy

While driving in his Honda Civic, Mullis had the flash of insight that two short DNA segments, oligonucleotide primers, could direct the amplification of a segment of DNA. At high temperature, the DNA segment would be denatured, and it could be annealed to short primers at a lower temperature. A DNA polymerase could be added, along with nucleotide substrates (dATP, dTTP, dCTP, and dGTP), to cause synthesis from the 3' end of each primer, using the annealed DNA as template. Where does the LSD come in shaping his imagination? I don't want to spoil the story - you'll just have to read about it.

Back in the early days of PCR work, the polymerase would need to be added fresh to the reaction at each temperature cycle, because thermostable enzymes were not commercially available. Of course, there were also no thermocyclers then, and so moving the tubes from one temperature bath to another every 30 seconds to a minute for several hours was a mind numbing job that fell to graduate students.

Nowadays, we have instruments for changing temperature that are much more sophisticated, but it is fundamentally no different than having a few pots of hot water at different temperatures. When our PCR machines start leaking their "coolant" all over the bench, the two become one and the same! But I digress.

	In the polymerase chain reaction, a DNA template is repetitively: denatured into single stranded molecules, annealed to specific oligonucleotide primers (one specific primer per strand), copied with DNA polymerase to extend the primers to the end of the DNA strand.
	The reaction-in brief And for all you visual learners, take a look at this step-by-step animation http://depts.washington.edu/~genetics/courses/genet371b-aut99/PCR_contents.html

Step 1: Denaturation (95oC-98oC)	Why must the DNA be denatured into single strands? Because without separation of strands, you would not be able to anneal (i.e. hybridize) specific primers in the next step.
Step 2: Annealing (45oC-65oC)	Primers in excess The annealing reaction is very efficient because the primers are "in excess" in the reaction. In a typical PCR reaction, 10,000 molecules of a template may be used, which is 1.6 x 10-20 moles (0.016 attomoles). On the other hand, 5 picomoles of each primer may be used (5 x 10-12 moles) -- that is a 3 x 108 fold excess. Temperature controls annealing rate The rate of annealing is controlled by adjusting the temperature of the solution. At 55 C under most PCR salt conditions, typical primers of 18 nt. in length efficiently hydrogen bond to a DNA template. Adjustments in the protocol are made to account for the G/C vs. A/T richness of the primer and the overall length. There are many programs or Web sites at which one may calculate the Tm (melting temperatures) based on sequence and salt condition.
Step 3: Extension (65oC-75oC)	You can see, from a comparison of the figures for step 1 and step 3, that we now have two double-stranded DNA copies of the sequences between the specific primers. By denaturing these two copies and repeating the annealing and synthesis steps, we can obtain four copies.
Repeat	Now if we repeat the process again, we can obtain eight copies. Note that the sequence between the two primers is being copied or "amplified" exponentially, whereas the original template is not. So, here's the thing. When you perform a PCR reaction, you have two oligonucleotides that anneal to two different strands of the DNA, and have 3' ends that point towards each other. Here's the image to keep in mind. If you start with "red colored" oligonucleotide primers, and had "blue" substrates (dNTPs), then your final product would look like this: You managed to amplify everything between (and including) the oligonucleotide sequences. The 5' ends of the two oligos are exactly the 5' ends of the product. Let me reiterate: exactly. Someone in the class always worries about the following problem, so if it happens that you are the one worried one this year, then you'll want to read this: During synthesis from the original template, the polymerase goes past the position where the other primer will bind. Like this: You are about to ask me happens to these "loose ends" that are longer than the intended product? Well, for one thing, you're really worrying about a very small problem. You should probably stop washing your hands so many times a day too! These longer versions are generated only from the original template, and not from the copies; as a result they are not generated at an exponential rate. After 30 cycles, you will have only made about 30 copies of these longer products (per template), but you will have made about 2 to the 30th power (about 1 billion) copies of the shorter version (per template). Why? because the longer products can't be used to make more of themselves - they only are templates for the shorter product. If you are still worried, don't worry! Be happy! Gaze at this picture some more: Trace it with your fingers on the screen. Make a model of it out of mashed potatoes. Build a larger model of it out of dirt, in your living room. Feel the overpowering urge to go to Wyoming to see the original. This is a really important image, and once you understand it, everything else will fall into place in your life.
An example:	Consider the following sequence - a little bit from Yersinia pestis. Only one strand is shown, and you'll have to imagine what the other strand looks like. By convention, the first nucleotide is a 5' end. 1 caggaaggcg gcaacgaagc gagtccccag gagcttacat cagtaagtga 51 ctggggtgaa cgacggcagc caacgcacat gcaactcgaa gtatgacggg 101 taaatgggtg agcttatgct cggaacaacg cattattcag ggggttaatt 151 gatagattga ccagccactg ccggacgtca tttgaggatt gtctgaatct 201 cttgccactc tagtttaatc atgtgaggta acaatatatg ctgatgaaga 251 gcaaatgggc tttaagcaat aattaacacg ataacaagga tgtactatgg 301 atacagttga agagctgggc gggacgtact tttatgcagg caagccgaat 351 ttaaaagcca gtgagctact atttatgatt ttctgtgaga atactgccag 401 ccagtttggt atgcaggatt tcggggctgt ggttgcgatt atttcgggta 451 gaagcaatct cttaacaaga ggaaagccca taggtgcaac aaaaggcaca 501 tcatacgcct ccaaagcggc acgaagtgta tttaagaaaa caaaattccc 551 atttgggatg tcgctaccta catggttagg cgggtatact ccatggacgg 601 cgagaaaagc gatggtgcgt aatatcgccc cgtttgttgg tcgttcgatc 651 cccctacttg gcctcatcat tattgctgct gacgtatcag caatcactta 701 ccgtacaatt cgtgactaca acatgatagc aagggggggc gataagctat 751 ggtagatgat attgaacaac gaatttatga tcttgtccgg ccttatgctg 801 gcgtctatgt gttcaagaga aagccagtat ctttgacccc tgatacagac 851 ttagacactg acctaagtat tgatgagctt gaaatagaag atttaatgaa 901 tgacttcttt aaagagttct ctgtacaaag aggtaatttc aatattaaaa 951 attacttccc tgacgttcct ttttctttca atccattcaa aaaaacagcg It contains a coding sequence of "unknown function" from nt 297 (an ATG start codon) to nt 755 (a TAG stop codon). How would you design oligonucleotides, each 18 nt in length, that would allow you to extract that coding sequence by PCR. You want only that sequence. Well, it is easy, and you only have to think about that really important picture (see above). The first oligonucleotide will start with nt 297 of the sequence shown, and go until nt 314. That gives you 18 nt as follows: 5' atggatacagttgaagag The other oligo will have a 5' end at nt 755, but it will be sequence from the other strand. Let me say that again, because it is the greatest cause of wrong oligonucleotides: It will be sequence from the other strand. It will look like this, and please note that the 5' end is on the right in this representation: ccgctattcgataccatc 5' So, I hear you thinking, "Where did that come from?" It is sequence from the strand that you have to imagine - the one that is base paired to the 1 kbp sequence that is shown. Where the Yersinia sequence has a TAG stop codon at 755, the G nucleotide at 755 is at the 3' end of the coding sequence. It is base paired to the C nucleotide at the 5' end of the oligonucleotide (at the right end, above). For example, the 5'-TAG base pairs to the ATC-5'. OK? What PCR product would we get? Here it is, in double-stranded form, and it should remind you strongly of that picture you can't get out of your mind. The red sequence is from the oligonucleotides, and the blue sequence was contributed by synthesis in the reaction: 297 5' atgg tacc 301 atacagttga agagctgggc gggacgtact tttatgcagg caagccgaat tatgtcaact tctcgacccg ccctgcatga aaatacgtcc gttcggctta 351 ttaaaagcca gtgagctact atttatgatt ttctgtgaga atactgccag aattttcggt cactcgatga taaatactaa aagacactct tatgacggtc 401 ccagtttggt atgcaggatt tcggggctgt ggttgcgatt atttcgggta ggtcaaacca tacgtcctaa agccccgaca ccaacgctaa taaagcccat 451 gaagcaatct cttaacaaga ggaaagccca taggtgcaac aaaaggcaca cttcgttaga gaattgttct cctttcgggt atccacgttg ttttccgtgt 501 tcatacgcct ccaaagcggc acgaagtgta tttaagaaaa caaaattccc agtatgcgga ggtttcgccg tgcttcacat aaattctttt gttttaaggg 551 atttgggatg tcgctaccta catggttagg cgggtatact ccatggacgg taaaccctac agcgatggat gtaccaatcc gcccatatga ggtacctgcc 601 cgagaaaagc gatggtgcgt aatatcgccc cgtttgttgg tcgttcgatc gctcttttcg ctaccacgca ttatagcggg gcaaacaacc agcaagctag 651 cccctacttg gcctcatcat tattgctgct gacgtatcag caatcactta ggggatgaac cggagtagta ataacgacga ctgcatagtc gttagtgaat 701 ccgtacaatt cgtgactaca acatgatagc aagggggggc gataagctat ggcatgttaa gcactgatgt tgtactatcg ttcccccccg ctattcgata 751 ggtag ccatc 5' Well it would be really nice if we could just draw a picture of what we wanted and could send that to a company that makes oligonucleotides - let them figure out the rest of it for us! Unfortunately, they want the order placed in a standard format, and that means we need to do one more little task. The company will want us to give them the sequences to make, written 5' to 3'. For the first oligo that is easy because it is already in that format: 5' atggatacagttgaagag The second oligo needs to be rotated so the 5' end is on the left. Remember that what we want is this: ccgctattcgataccatc 5' So when it is rotated 180 degrees it looks like this: 5' ctaccatagcttatcgcc That's what we tell the company we want for the second oligo. It is hard to look at this and see that it really amounts to nt 738 to nt 755 of the Yersinia sequence, because it seems upside down and backwards. In fact, we call it the "reverse complement" which means pretty much the same thing. Remember - This image tells you how to solve the problem of oligo design.
An overview of what is needed:	Here's the recipe: A pair of short oligonucleotide primers specific for a DNA sequence, with the ability to hybridize to the opposite strands of that molecule (3' ends pointing "towards" each other): A DNA template. A thermostable DNA polymerase (such as Taq or Pfu polymerase), and all four dNTP substrates (meaning dATP, dGTP, dCTP, dTTP) A machine that can change the incubation temperature of the reaction tube automatically, cycling between approximately 98 C (for denaturation), 55 C (for oligonucleotide annealing), and 72 C (for synthesis).
Where does the thermostable polymerase come from?	These days, the thermostable polymerases are commercial products, but not too long ago they were only found in hot springs (such as this one at Yellowstone National Park). 1979

The temperature changes:

When you program the thermocycler, you specify a series of temperatures and times, such as: Temperature Time 98 C 30 seconds 55 C 30 seconds 72 C 60 seconds ...and specify the number of times this series should be repeated (for example, 35 times). Multiple program segments may be linked together, as in the following example: Temperature Time program segment 1, do 1 time: 98 C 5 minutes program segment 2, do 35 times: 98 C 30 seconds 55 C 30 seconds 72 C 60 seconds program segment 3, do 1 time: 72 C 10 minutes program segment 4, do 1 time: 4 C 999 minutes What was the purpose of each of these segments? Program segment #1: To denature the template fully, prior to the first synthetic step. If this step is excessive, there can be damage to the enzyme or template, reducing the efficiency. If too short, the template is not available for synthesis. Program segment #2: To amplify the DNA fragment, with the following steps taken: Denature DNA at 96 C Anneal oligonucleotides at 55 C Synthesize DNA at 72 C The individual temperatures (96, 55, 72) may be optimized for each reaction, however the thermostable polymerases generally work well at 72-74 C, and typical oligonucleotides anneal well at 45-65 C. Program segment #3: Finish synthesis of any partially completed fragments. Program segment #4: Cool samples while waiting for researcher to finish nap. In this type of program, the temperature changes are as rapid as the machine can manage, usually taking 30 seconds to a minute to complete. Some advanced machines can change the temperature between these steps in just seconds, and these speed up the PCR process considerably. This type of temperature profile could be represented by a square wave plot. Step cycle file There are times when you don't want the temperature changes to be rapid, and here's an example: Suppose we are trying to work out the conditions for a polymerase chain reaction using two degenerate oligonucleotides that are approximately 1000-fold degenerate. What do we mean by degenerate? We mean that there are various different versions of the oligonucleotide in the reaction. We do this when we have a pretty good idea of the protein sequence but not the DNA sequence encoding it. For example, we might use a collection of oligonucleotide primers that was degenerate at the third, sixth and ninth positions, to cover all of the degeneracies of the genetic code in that region, as shown below. There are 32 different ones, and they all encode Thr-His-Ala-Thr-Ser-Thr-Ala-Asn ("THATSTAN" in one-letter amino acid code). 5' ACCCATGCCACCTCCACCGCCAAT 5' ACACATGCCACCTCCACCGCCAAT 5' ACTCATGCCACCTCCACCGCCAAT 5' ACGCATGCCACCTCCACCGCCAAT 5' ACCCATGCAACCTCCACCGCCAAT 5' ACACATGCAACCTCCACCGCCAAT 5' ACTCATGCAACCTCCACCGCCAAT 5' ACGCATGCAACCTCCACCGCCAAT 5' ACCCATGCTACCTCCACCGCCAAT 5' ACACATGCTACCTCCACCGCCAAT 5' ACTCATGCTACCTCCACCGCCAAT 5' ACGCATGCTACCTCCACCGCCAAT 5' ACCCATGCGACCTCCACCGCCAAT 5' ACACATGCGACCTCCACCGCCAAT 5' ACTCATGCGACCTCCACCGCCAAT 5' ACGCATGCGACCTCCACCGCCAAT 5' ACCCACGCCACCTCCACCGCCAAT 5' ACACACGCCACCTCCACCGCCAAT 5' ACTCACGCCACCTCCACCGCCAAT 5' ACGCACGCCACCTCCACCGCCAAT 5' ACCCACGCAACCTCCACCGCCAAT 5' ACACACGCAACCTCCACCGCCAAT 5' ACTCACGCAACCTCCACCGCCAAT 5' ACGCACGCAACCTCCACCGCCAAT 5' ACCCACGCTACCTCCACCGCCAAT 5' ACACACGCTACCTCCACCGCCAAT 5' ACTCACGCTACCTCCACCGCCAAT 5' ACGCACGCTACCTCCACCGCCAAT 5' ACCCACGCGACCTCCACCGCCAAT 5' ACACACGCGACCTCCACCGCCAAT 5' ACTCACGCGACCTCCACCGCCAAT 5' ACGCACGCGACCTCCACCGCCAAT Who knew thatstan could be so degenerate? It gets worse! We would like to use that handy web site to determine the Tm, so we would know what annealing temperature to program into the machine, but we don't actually know which of the 1000 versions of each oligonucleotide will be an exact match to the target sequence. What we would really like to do is to introduce some flexibility into the temperature cycle, so that every potential oligonucleotide has a fair chance of annealing to the target. What do we do? Answer: We program the temperature cycler so that it gradually changes the annealing temperature, thereby exposing the reaction to a range of temperatures. In this kind of program, the timing at each temperature and between each temperature are specified. Rapid changes can be programmed by setting a "between temperature" time of only one second (it obviously takes longer than that to change temperatures, so the machine just does its best). In this example, the temperature gradually increases from 55 C to 65 C over a 1 minute period. Thermocycle file Otherwise, you will notice how similar it is to the square-wave version described before. There's always a bit of time taken in changing temperatures, and sometimes it makes the reaction work better. To get very fast temperature changes, you need to have good contact between the tube and the walls of the heating block. They need to fit together perfectly (not too much air space). Also, it is common to use "thin walled" tubes for polymerase chain reactions. These tubes transmit the temperature changes faster, but the downside is that they aren't very strong. You wouldn't want to use them in a high speed centrifuge for example. Another factor in temperature changes is the thermal mass of your reaction. A 10 microliter reaction can be brought to temperature faster than a 100 microliter reaction.

If you've got your MasterCard ready, here are some of the models (past and present) from the Perkin Elmer (Applied Biosystems) showroom: DNA Thermal Cycler 480 GeneAmp PCR System 2400 GeneAmp PCR System 9600 Dual 384-Well GeneAmp® PCR System 9700 GeneAmp® PCR System 2700 The machines have a metal "hot block" that conducts heat to the samples, and a heating/cooling fluid that circulates through the inside of the metal block to change the temperature.